Phosphohistidine phosphatase

Author: kpkz

August undefined, 2024

WebGene ID: 122554492, updated on 31-Aug-2024. Summary Other designations. 14 kDa phosphohistidine phosphatase WebPhosphohistidine phosphatase 1 (PHPT1), also named protein histidine phosphatase (PHP), is a eukaryotic enzyme dephosphorylating proteins and peptides that are phosphorylated …

In Vitro Assays for Measuring Protein Histidine Phosphatase …

WebNational Center for Biotechnology Information Although a clear consensus has not been reached, a large number of scientists adhere to a substrate-transport model to account for the catalytic properties of glucose 6-phosphatase. In this model, glucose 6-phosphatase has a low degree of selectivity. The transfer of the glucose 6-phosphate is carried out by a transporter protein (T1) and the endoplasmic reticulum (ER) contains structures allowing the exit of the phosphate group (T2) and glucose (T3). involves disengaging from social roles

127006239 - Gene ResultLOC127006239 14 kDa phosphohistidine phosphatase …

WebLHPP抗体,Phospholysine phosphohistidine inorganic pyrophosphate phosphatase, hLHPP, 3.1.3.-, 3.6.1.1, LHPP. This LHPP antibody is generated from a rabbit immunized with a KLH conjugated synthetic peptide between 84-116 amino acids from the Central region of human LHPP. Disclaimer note: The observed molecular weight of the protein may vary ... WebApr 1, 2016 · Phosphohistidine phosphatase 1 (PHPT1), the only known phosphohistidine phosphatase in mammals, regulates phosphohistidine levels of several proteins including those involved in signaling,... WebAug 21, 2015 · Structures of the three forms of phosphohistidine: (A) 1-phosphohistidine; (B) 3-phosphohistidine; (C) 1,3-diphosphohistidine. In prokaryotes it is now recognized that that both serine/threonine and tyrosine kinases, as well as their cognate phosphatases also occur (for reviews, see Bakal and Davies, 2000; Pereira et al., 2011; Chao et al., 2014 ). involves disregarding accepted principles

1H, 13C, and 15N resonance assignments of human phosphohistidine …

WebJul 12, 2009 · A mammalian 14-kDa phosphohistidine phosphatase, also denominated PHPT1, was found 6 years ago that provided a new tool in the study of phosphohistidine phosphorylation. The localization of PHPT1 mRNA by Northern blot analysis revealed high expression in heart and skeletal muscle. The main object of the present study was to … WebApr 1, 2016 · Phosphohistidine phosphatase 1 (PHPT1), the only known phosphohistidine phosphatase in mammals, regulates phosphohistidine levels of several proteins including those involved in signaling, lipid metabolism, and potassium ion transport. While the high-resolution structure of human PHPT1 (hPHPT1) is available and residues important for … involve selectionWebDec 1, 1993 · We have detected phosphohistidine and phospholysine phosphatase activities in rat tissue extracts using partially phosphorylated, high-molecular-mass (> 10 kDa) … involves definition synonym

"WebPhosphohistidine phosphate inorganic pyrophosphatase (LHPP)is a member of the haloacid dehalogenase like hydrolase domain-containing (HDHD) gene family. It is also a new kind of inorganic pyrophosphatase (PPase), which is considered to be essential for life and closely related to cell survival, growth, and differentiation. " - Phosphohistidine phosphatase

Phosphohistidine phosphatase

WebJul 24, 2024 · Yokoi et al. (2003) concluded that LHPP, like bovine Lhpp, may function as a protein phosphatase that hydrolyzes phospholysine and/or phosphohistidine. Hindupur et al. (2024) demonstrated that LHPP is indeed a protein histidine phosphatase. Consistent with these observations, global histidine phosphorylation was significantly upregulated in ... WebDec 4, 2024 · Phosphohistidine phosphatase 1 (PHPT1) also dephosphorylates phospholysine of chemically phosphorylated histone H1 and polylysine. Ups J Med Sci 2015; 120 :20–27. Article Google Scholar

Did you know?

WebDec 4, 2024 · First structure of a eukaryotic phosphohistidine phosphatase. J Biol Chem 2006;281:33830–33834. Article CAS PubMed Google Scholar Ma RX, Kanders E, Sundh UB et al. Mutational study of human ... WebNov 10, 2024 · Although protein histidine phosphorylation was discovered in 1962 [], the enzymes responsible for dephosphorylation of phosphohistidine (pHis) in mammals were not discovered until much more recently [2,3,4,5,6,7,8].One of the major challenges in the field is the lability of pHis under relatively mild conditions [6,7,8], making the adduct much …

WebNov 23, 2024 · Here we identify the mechanism by which a bacterial phosphohistidine phosphatase dephosphorylates the nitrogen-related phosphotransferase system, a … WebApr 1, 2016 · Phosphohistidine phosphatase 1 (PHPT1), the only known phosphohistidine phosphatase in mammals, regulates phosphohistidine levels of several proteins including …

WebResearch in the field of protein-bound phosphohistidine phosphorylation has been hampered by the difficulties in analysis and detection of phosphohistidine. Therefore a … WebNov 10, 2006 · The structure of phosphohistidine phosphatase (PHPT1), the first identified eukaryotic-protein histidine phosphatase, has been determined to a resolution of 1.9Å …

WebJun 16, 2024 · Phosphohistidine (pHis) was discovered 60 years ago as a mitochondrial enzyme intermediate; since then, evidence for the existence of and phosphohistidine has emerged, together with examples where protein function is regulated by reversible histidine phosphorylation. pHis is chemically unstable and has thus been challenging to study.

WebPhospholysine phosphohistidine inorganic pyrophosphate phosphatase: Lhpp: CCCTGGGAAAAGGACGCTATT AATCATGATGGCCTGGTGGG: Mechanistic target of rapamycin kinase: Mtor: CACCCATCCAACCTGATGCT ATCGAGACCGGTAACCTCCA: Regulatory associated protein of MTOR, complex 1: Rptor: TGGGTCTTCAACAAGGTAGC … involve serviceWebPTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This protein contains a C-terminal PTP domain and an N-terminal domain homologous to the band 4.1 superfamily of cytoskeletal-associated proteins. involves dna replicationWebkaryotic and eukaryotic phosphohistidine phosphatases have been reported. Here we identify the mechanism by which a bacterial phosphohistidine phosphatase … involves dozens of prior hurtsWebSep 27, 2024 · The K Ca 3.1 auxiliary subunits that positively or negatively control its activity as well as T-cell function have been identified: phosphoinositide-3-kinase, class 2, β polypeptide (PI3K-C2B), nucleoside diphosphate kinase-B (NDPK-B), phosphohistidine phosphatase 1 (PHPT1), myotubularin-related protein 6 (MTMR6), tripartite motif … involve selection limitedWebPhosphohistidine phosphatase 1 (PHPT1), also named protein histidine phosphatase (PHP), is a eukaryotic enzyme dephosphorylating proteins and peptides that are phosphorylated on a histidine residue. involves fitting a person to the right jobWebSixA was first reported to be a phosphohistidine phosphatase that dephosphorylates the histidine-containing phosphotransfer domain of the E. coli sensor kinase ArcB ( 32 , 41 ), and the activity was shown to be dependent on the conserved active-site histidine (His8) of SixA. involve selection ltdWebNov 28, 2024 · Phosphohistidine phosphatase 1 (PHPT1), one of the few known protein pHis phosphatases, regulates important cellular processes, and its genetic knockdown … involve service user involvement